ПЦР
Введение

ПЦР - полимеразная цепная реакция.Это метод позволяющий сделать множество копий нужного нам участка из днк.Метод очень чуствительный - имея всего несколько молекул днк , можно получить миллион ампликонов(участков исходной днк).Так что это не только метод для получения копий днк, но и для диагностики заболеваний - ведь заболевания часто бывают из-за изменений в ДНК.

Помимо амплификации ДНК, ПЦР позволяет производить множество других манипуляций с нуклеиновыми кислотами (введение мутаций, сращивание фрагментов ДНК) и широко используется в биологической и медицинской практике, например, для диагностики заболеваний (наследственных, инфекционных), для установления отцовства, для клонирования генов, выделения новых генов.


ПЦР смесь

ПЦР проводят в амплификаторе — приборе, обеспечивающем периодическое охлаждение и нагревание пробирок


Термоциклер
ПЦР обычно состоит из повторяющихся этапов:

  1. денатурация ДНК образца - 92-96С, время 15-30 сек.
    Расплетание двойной спирали днк.Чем длиннее днк тем более высокая температура нужна для денатурации


    Денатурация


    Денатурация
  2. отжиг - 53-61С, время 40 сек
    Присоединение праймеров к днк.Праймеры - короткие, химически синтезированные днк-молекулы, которые необходимы для начала работы днк-полимеразы. Во время отжига температура понижается и праймеры получают возможность комплементарно спариться с матрицей.


    Посадка праймеров
  3. элонгация - 55-75, время 20-50 сек, зависит от длинны амплифицируемого участка.


    Присоединение полимеразы и синтез
    ДНК полимераза удлинняет праймеры спарившиеся с матрицей - достраивает их нуклеотид за нуклеотидом, тоесть получается вторая цепочка днк комплементарная первой. Но достраивание праймеров происходит всегда только в одном направлении.Поэтому на первом цикле у нас получаются половинчатые днк, а уже на втором цикле получается участок днк(ампликон) который находиться между праймерами в исходной матрице.На следующем цикле он полностью копируется и получается новая молекула днк.Из исходной матрицы тоже получаются недоделанные(половинчатые) днк, но их прирост идет медленно - линейно, в то время как ампликоны копируются экспоненциально, потому что с каждого нового ампликона начинают делаться копии. ДНК полимераза - это фермент, который в природных условиях присутствует в клетках и занимается репликацией днк, когда клетки захотят разделиться. Taq полимераза - разновидность этого фермента, выделенная из специальных бактерий-термофилов, живущих в горячих источниках, и соответственно такая полимераза стабильна и не повреждается при высоких температурах.
Эти 3 шага повторяются 23-35 раз, также есть еще начальный шаг прогрева полимеразы обычно он с температурой шага1) но длительность 60-120 сек

Важнейшая характеристика праймеров — температура плавления (Tm) комплекса праймер-матрица.
Tm — температура, при которой половина ДНК-матриц образует комплекс с олигонуклеотидным праймером.
Упрощенная формула для подсчета температуры плавления 20 буквенного праймера, по его нуклеотидной последовательности
Tm(плавление праймеров)=(G+C)*4 + (A+T)*2
A - кол-во букв A в праймере
C - кол-во букв C в праймере
T - кол-во букв T в праймере
G - кол-во букв G в праймере
Например: GTGAGTCCCTGAATGTAGTG
Tm=(7+3)*4+(4+6)*2=60

Время "полураспада" Taq полимеразы в зависимости от температуры:
92.5oС 130'
95.0oС 40'
97.5oС 5-6'
DNA разрушается при нагреве - при 96.5C в водной среде разрушается за 2.5 минуты, поэтому в шаге 1) всегда ищется компромисс между - не сильно повредить ДНК и полимеразу и хорошо денатурировать ДНК.

Необходимые материалы
  • минеральное масло (например, вазелиновое медицинское) - 8 мкл
    Так как у нас термоциклер без подогреваемой крышки, то без масла - содержимое пробирки будет испаряться потихоньку.Масло ложиться сверху и не дает нижней части испаряться.
    Масло можно заменить парафином - желательно достаточно чистый - производстава какого-нибудь хорошего брэнда.После пцр парафин легко протыкается носиком от пипетки, но можно и физически удалить
  • образец днк (матрица), участок которого хотим размножить(этот участок называют ампликон) - 1 мкл
    В моем случае матрица была такая:
    - смесь из очень-очень многих кднк (вобщем это обычная ДНК) фрагметов сделанных из рнк растения - динна - в среднем 1600 бп
  • 2 праймера по 20-25 пн, каждый объемом 2 мкл
    Каждый праймер - на свою сторону двойной спирали днк
    1-й праймер(прямой) копируем из последовательности нужного нам участка(гена), для этого находим в инете(сайт ncbi) последовательность этого участка
    2-й праймер(обратный) копируем другой участок (концевой) дальше по этому гену с сайта ncbi берем его комплементарную последовательность (можно перевести с помощью тулзы на молбиоле)
    Праймеры обычно заказываются (синтезируются) в фирме.
    В моем опыте использовались праймеры:
    прямой - 5'-AAGATTGAGATCAAGCGGATCGA-3'
    и обратный - 5'-CTCTCTCATTCTCAGMAATCTTTG-3'.
    По данным праймерам BLAST выдал участок (тот который мы и хотим амплифицировать) длинной 517 бп. Участок очень легкоплавкий (А/Т-богатый) - днк с такими участками разъединяется на 2 отдельные цепочки при меньшей температуре. Буква М в праймере - специальное обозначение (см. тут Molbiol )
  • дистиллированная вода - 16.5 мкл ( на остаток объема после всех остальных компонентов)
    А конечный объем смеси который мы хотим - 25 мкл
  • буфер PCR реакционный обеспечивающий необходимые условия реакции — рН, ионную силу раствора с Ионами Mg2+, необходимые для работы полимеразы - 2.5 мкл
    Тк у нас конечный объем 25 мкл то если буфер 10-кратный ( обозначение 10х на пробирке ) берем 25/10 = 2.5 мкл буфера
  • Taq полимераза(термостабильная (>95C) днк полимераза ) - 0.5 мкл
  • нуклеотиды dNTP (Дезоксирибонуклеозидтрифосфаты dATP, dGTP, dCTP, dTTP.) 50x - 0.5 мкл Тк 50x то получаем 25 мкл/50=0.5 мкл
  • Термоциклер(амплификатор)
    Термоциклер стоит дорого.Поэтому альтернативы всего 2:
    1. купить OpenPCR (500$) , но ее еще и придется собрать самому)
    2. сделать самим - все что требуется - установка и поддержание температуры с необходимой точностью и циклическая смена температур). На первый взгляд ничего сложного, но придется повозиться с нагревательным блоком и написанием программы.
      Здесь подробные инструкции. Я использовал свой термоциклер


      SimpleCycler
  • Прибор для электрофореза - результат ПЦР ведь надо как то посмотреть
Протокол
  1. Обычно делают 2 пробирки - с образцом и контрольную(без образца-днк ) чтоб удостовериться что у нас нет контаминации реагентов (загрязнения нашей днк - другими днк, попавшими например из предыдущих экспериментов через руки, пипетку и тд..) Если будет результат после ПЦР от первой пробирке - то это то что нам и нужно , а не какойлибо другой случайно попавший участок днк. Соответственно в контроле - на выходе продукта не должно быть
  2. в термоциклере устанавливаем следующую программу
    92С 90 сек денатурация + подготовка полимеразы
    далее цикл на 27 повторов
    1) 92С 23 сек денатурация (можно 10-15 сек)
    2) 55С 35 сек отжиг (можно 20-30 сек)
    3) 70С 20 сек элонгация (можно 40сек - 2 мин зависит от длинны участка днк) + возврат на шаг 1)
  3. собираем ПЦР смесь в пробирку с конечным объемом 25 мкл:
    1) праймер 1, 2 мкл
    2) праймер 2, 2 мкл
    3) вода 16.5 мкл ( на остаток объема после всех остальных компонентов)
    4) буфер 10x реакционный ПЦР с Mg 2.5 мкл. Тк у нас конечный объем 25 мкл то если буфер 10-кратный берем 25/10 = 2.5 мкл буфера
    5) Taq полимераза 2-3 единицы 0.5 мкл
    6) dNTP 50x ( 4 нуклеотида) 0.5 мкл ( тк 50x то получаем 25 мкл/50=0.5 мкл)
    7) ДНК 1 мкл
    Продаются и готовые ПЦР смеси - в которые только остается добавить образец днк и праймеры.
  4. В пробирку сначала добавляем воду а потом остальное
  5. Если будем делать контрольную пробирку то сначала проще приготовить смесь всех компонентов без днк в удвоенном объеме - для норм пцр и контроль Далее делим на 2 пробирки и в 1 из них добавим образец.
  6. ставим пробирку в прибор, включаем и ждем - примерно на полтора часа получается
  7. полученный продукт добавляем в гель и форезим + маркеры, должна быть четкая полоска на нужную длинну копируемого участка гена. А в контроле ничего не должно быть
  8. при желании из геля можно вырезать этот кусок и китом(с фильтровальной колонкой) выделить нашу днк


Форез моих результатов ПЦР, с маркером, трансиллюминатором и нормальным фотиком


Форез моих результатов ПЦР на вебкамеру с бытовой УФ лампой
Ссылки
http://asena.livejournal.com/300160.html
http://ru.wikipedia.org/wiki/Полимеразная_цепная_реакция
http://www.potrebitel.ru/newweb/?go=article&num_id=56&mag_id=7&cid=3480




Видео
http://www.bio.davidson.edu/Courses/immunology/Flash/RT_PCR.html
http://www.dnalc.org/resources/animations/pcr.html
http://youtu.be/2KoLnIwoZKU
http://www.maxanim.com/genetics/PCR/PCR.htm
http://www.sumanasinc.com/webcontent/animations/content/pcr.html
http://www.bio-rad.com/LifeScience/jobs/2004/04-0522/04-0522_PV92_PCR.html
X